(ZIP 3 MB) Additional file 7: Table S7. Statistically significantly

differentially expressed probe sets in the gingival tissues eFT508 according to levels of P. micra in the adjacent pockets. (ZIP 3 MB) Additional file 8: Table S8. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of C. rectus in the adjacent pockets. (ZIP 3 MB) Additional file 9: Table S9. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of E. corrodens in the adjacent pockets. ALK inhibitor (ZIP 3 MB) Additional file 10: Table S10. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of V. parvula in the adjacent pockets. (ZIP 3 MB) Additional file 11: Table S11. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of A. naeslundii in the adjacent pockets. (ZIP 3 MB) Additional file 12: Table S12. A list of the top 100 differentially expressed probe sets in the gingival tissues according to levels of ‘Etiologic burden’ in the adjacent pockets. (XLS 32 KB) Additional file 13: Table S13.

A list of the top 100 differentially expressed probe sets in the gingival this website tissues according to levels of ‘Putative burden’ in the adjacent pockets. (XLS 26 KB) Additional file 14: Table S14. A list of the top 100 differentially expressed probesets in the gingival tissues according to levels of ‘Health-associated burden’ in the adjacent pockets. (XLSX 17 KB) Additional file 15: Table S15. List of all statistically significantly regulated GO groups in the gingival tissues according to levels of each of the 11 investigated species in the adjacent pockets. (ZIP 646 KB) References 1. Socransky SS, Haffajee AD: Periodontal microbial ecology. Periodontol 2000 2005, 38:135–187.CrossRefPubMed 2. Marsh PD: Dental plaque: biological significance of a biofilm and community lifestyle. J Clin Periodontol 2005,32(Suppl 6):7–15.CrossRefPubMed 3. Listgarten MA, Helldén Ureohydrolase L: Relative distribution of bacteria at clinically healthy and periodontally diseased sites in humans. J Clin Periodontol

1978,5(2):115–132.CrossRefPubMed 4. Socransky SS, Haffajee AD, Smith C, Dibart S: Relation of counts of microbial species to clinical status at the sampled site. J Clin Periodontol 1991,18(10):766–775.CrossRefPubMed 5. Page RC, Schroeder HE: Pathogenesis of inflammatory periodontal disease. A summary of current work. Laboratory investigation; a journal of technical methods and pathology 1976,34(3):235–249.PubMed 6. Offenbacher S: Periodontal diseases: pathogenesis. Ann Periodontol 1996,1(1):821–878.CrossRefPubMed 7. Chung CH, Bernard PS, Perou CM: Molecular portraits and the family tree of cancer. Nat Genet 2002,32(Suppl):533–540.CrossRefPubMed 8. Quackenbush J: Microarray analysis and tumor classification. N Engl J Med 2006,354(23):2463–2472.CrossRefPubMed 9.

schenckii sssod, ssnramp, sssit and ssgapdh gene homologues Emricasan mouse were obtained using XAV939 RLM-RACE (Applied Biosystems, Foster City, CA, USA) with S. schenckii cDNA as template. All RACE reactions were carried out in the ABI PCR System 2720 (Applied Biosystems). The touchdown PCR and nested PCR parameters used for the initial RACE reactions were the same as described previously [26]. Nested primers were designed

to improve the original amplification reactions. Bands from the 5′ nested PCR were excised from the gel and cloned as described above. Primers for RACE were designed based on the sequence obtained from the yeast two-hybrid assay. For the initial 5′ RACE of sssod gene the following primers were used: GSP-UTR-1(rev) 5′ actcttctggctgtcaccgtccccgtc 3′; NGSP-UTR-2 (rev) 5′ cgccgtccgtcctatgtcttcaacttc 3′; GSP-AWTQHMTLNL (rev) 5′ ggttgagcatcagggtcatgtgctgcgtccaggc 3′; NGSP-RSIHHLPV (rev) 5′ gacacgggcaggtggtgtatgctgcgg PD-1/PD-L1 targets 3′; GSP-HNTDFFFKH (rev) 5′ tgcttgaagaagaagtcggtgttgtgg 3′ and NGSP-TTYEDREL (rev) 5′ ctcttgagctcgcggtcctcgtatgtggtgc 3′. For PCR the primers used were: forward primer WTQYMTL (fw) 5′ ttggacccagtacatgaccctgat 3′ (obtained from the published sequence of the G.

zeae sod gene, GenBank accession no. XP_387245.1) and lower primer HVWLRDYG (rev) selleck chemical 5′ agcccgtagtcccgcagccacacgtg 3′. For RTPCR the following primers were used: MFRPR (fw) 5′ gcaccatgttccgtccgagg 3′ and PSLWKQP (rev) 5′ ctgcttccacaggctcgggt 3′. For 5′ RACE of ssnramp gene the following primers were used: GSP-TASSTSTSDI (rev) 5′ ccaatgtcgctcgtactgctcgctgtc 3′; NGSP-TSFDKYMT (rev) 5′ cggtcatgtacttgtcaaacgatgtga 3′; NGSP-VVEVAVSLF (rev) 5′ aaagagcgagacggcgacctcaacaac 3′; GSP/NGSP-LSMIDHTT (rev) 5′ tgtggtgtggtcaatcatggacagc 3′ and NGSP-WKVVSSLR (rev) 5′ cctaagactagagacgaccttccag 3′. The complete cDNA coding sequence of ssnramp was confirmed

using RTPCR with cDNA as template and the following primers: UP-1(fw) 5′ tgttcactacttgggctgt 3′ and LW-1 (rev) 5′ gcttgtgttagttgcccttg 3′. For 5′ RACE of the sssit gene, the following primers were used: GSP-SVVTLFASV (rev) 5′ gacggaagcaaagagtgtaacgacaga 3′; NGSP-SLRKYDFND (rev) 5′ tcattgaagtcgtactttcgtaaggat 3′; GSP/NGSP-QLIFCLSS (rev) 5′ gggatgaaaggcagaatatgagctgcg 3′; GSP/NGSP-LIHRTTHR (rev) 5′ tcggtgtgtggtacggtggattaac 3′; GSP-LEWRGFFS (rev) 5′ cgctgaagaagccacgccattccaatg 3′; GSP-TESPKGHE (rev) 5′ ctcgtgccctttaggagattccgt 3′ and NGSP-STHPAD (rev) 5′ gatcatctgcgggatgtgtagaca 3′. The complete cDNA coding sequence of the sssit gene was confirmed using RTPCR. cDNA was used as template for RTPCR and the following primers: UP-Sit (fw) 5′ ttcaatacagcataacgccactgatc 3′ and LW-Sit (rev) 5′ aaaacagtgttccgtacttactacta 3′.

21. Swofford DL: PAUP: Phylogenetic analysis

using parsimony (and other methods), Version 4. Sunderland, MA: Sinauer Associates 1998. 22. Kumar S, Tamura K, Nei M: MEGA3: Integrated www.selleckchem.com/products/cbl0137-cbl-0137.html Software for Molecular Evolutionary Genetics Analysis and Sequence Alighnent. Briefings in Bioinformatics 1994, 5:150–163.CrossRef Authors’ contributions TSS: Conception, acquisition and analysis of data, interpretation of data, drafting of manuscript, approved final draft. RTO: Analysis and selleck chemicals llc interpretation of data, drafting of manuscript, approved final draft, BW: Acquisition and interpretation of isolate data, approved final draft, RE: Acquisition and interpretation of DNA signature data, approved final draft, LYH: Acquisition and interpretation of DNA signature data, approved final draft, Buparlisib in vivo JMUR: Acquisition and interpretation of DNA signaturedata, approved final draft, MD: Acquisition and interpretation of DNA signature data, approved final draft, SRZ: Acquisition and interpretation of DNA signature data, approved

final draft, LJK: Provide insight for relationship between worldwide and Chinese isolates, approved final draft, JB: Acquisition and interpretation of data, approved final draft, JMS: Acquisition and interpretation of data, approved final draft, TP: Input on phylogenetic analysis of datasets, draft manuscript, approved final draft, DMW: Provide insight into geographical relationships between worldwide isolates, draft manuscript, approved final draft, AH: Provide data and genotyping

information for new Texas isolates belonging to Ames sub-lineage, approved final draft, JR: Initial sequencing, assembly and analysis of genomes, approved final draft. PK: Responsible for concepts, vision and direction for the entire project, draft manuscript, approved final draft.”
“Background Environmental contamination from domestic and industrial waste discharges has become a major public health concern. Wastewater treatment processing includes a final disinfection stage which eliminates pathogenic microorganisms (bacteria, virus and protozoa). Water disinfection can be achieved using chlorine, chlorine dioxide, hypochlorite, ozone or ultraviolet radiation. Although very efficient against a large clonidine range of microorganisms, the implementation of these solutions for wastewater treatment has been limited by environmental factors, namely the formation of toxic by-products from chorine [1], or by economic factors, as ultraviolet radiation and ozone treatment that are very expensive options to apply. Thus, as water reuse may be a way to cope with low water availability [2] in densely populated areas, more convenient and inexpensive technologies of water disinfection are needed [3]. Photodynamic antimicrobial therapy has recently been used to efficiently destroy microorganisms.

In the example of Fig. 6, the pulse-modulated ML was triggered with 100 kHz pulse-frequency at 100 μs before onset of 440 nm AL. At 1 ms after onset of AL, a saturating 50-μs multi-color ST pulse was applied. The ST pulse closes PS II reaction centers transiently, so that the I 1-level of fluorescence yield can be determined by extrapolation to 1,050 μs. I 1 corresponds to the maximal fluorescence yield that can be reached in the presence of an oxidized PQ-pool (for apparent PQ-quenching see Samson et al. 1999; ICG-001 Schreiber 2004). Weak FR background light or short FR-preillumination

is routinely applied to assure a fully oxidized PQ-pool. This aspect is particularly important in the study of algae and cyanobacteria, where depending on conditions the PQ-pool Tipifarnib mw becomes more or less reduced in the dark via NADPH-dehydrogenase activity, resulting Fer-1 concentration in more or less transition into state 2. Furthermore, FR-preillumination minimizes the contribution of “inactive PS II” to the O–I 1 kinetics. Fig. 6 Initial increase of fluorescence yield (O–I 1 rise) in a dilute suspension of Chlorella (300 μg Chl/L) induced

by 440-nm AL with 2,131 μmol quanta/(m2 s) in presence of FR background light. Dashed yellow lines indicate F o-level (O), assessed during a 50-μs period preceding onset of AL at time zero, and the I 1-level that is determined with the help of a saturating single-turnover pulse (ST) triggered 1 ms after onset of AL (see Fig. 2 for the Fast Kinetics trigger pattern). The slope of the relaxation kinetics is extrapolated to the end of the 50-μs ST. The black line represents the O–I 1 fit curve based on a PS II model which incorporates energy transfer between PS II units and reoxidation

of the primary PS II acceptor QA (see text) At a first approximation, assuming that the AL-driven increase of fluorescence yield is linearly correlated with accumulation of Q A − , and that the initial rise is negligibly slowed down by Q A − reoxidation, the kinetics can be described by a first order reaction, of which the time constant Tau = 1/k(II) corresponds to the time for reaching a QA-reduction level of 100(1 − 1/e) = 63.2 %. When this approximation is applied to the O–I 1 rise Interleukin-3 receptor of Fig. 6, Tau = 0.379 ms is estimated. A thorough analysis of the O–I 1 rise kinetics, however, has to take into account both Q A − reoxidation and nonlinearity between ∆F and the fraction of reduced Q A. This can be achieved by a fitting routine we have specially developed for this purpose (see “Materials and methods”). For the O–I 1 rise displayed in Fig. 6, which was driven by 2,131 μmol quanta/(m2 s) of 440-nm AL, the following values were estimated by the O–I 1 fit routine: Tau = 0.173 ms, k(II) = 1/Tau = 5.78 × 103/s, Tau(reox) = 0.340 ms, J = 2.01 (corresponding to p = 0.67), Sigma(II)440 = 4.51 nm2.

Therefore, it is possible that these athletes already had higher basal concentration of NO than general population and certain patients [53]. Thus, arginine supplementation did not provide any additional effect on NO

production in our subjects. The lack of effect of carbohydrate supplementation, with or without BCAA and arginine, on the performance of high-intensity intermittent exercise is in contrast to previous studies in which low muscle glycogen content contributed to the development of fatigue in such type of exercise [2, 4, 54, 55]. Although muscle biopsy was not performed, the exercise protocol used in our study would significantly CH5183284 manufacturer reduce the glycogen content in the working muscles. It has been shown that Proteasome structure a single bout of 30-s all-out cycling reduced muscle glycogen by approximately 24% [56]. In addition, muscle glycogen selleck chemicals llc levels were decreased by 19.6-36.4% after 10 to 15 bouts of 6-s

all-out cycling, interspersed with 30-s rests [2, 57]. Therefore, the decrease in muscle glycogen after our simulated matches would be similar, or even larger, than that in real wrestling matches [22]. Even though the glycogen content in the working muscles would be significantly decreased after two simulated matches in our study, the performance in match 3 was not significantly different from the previous two matches in all 3 trials. One possible explanation is that these experienced wrestlers have the ability to recover quickly from

the previous matches. In agreement, it has been reported that grip strength, isometric upper body pull strength, hip and back strength, vertical jump, and isokinetic knee extension peak torque were all generally maintained throughout a 2-day, 5-match freestyle wrestling tournament [23]. A recent study on a 1-day 5-match Greco-Roman much wrestling tournament also revealed that these parameters were generally maintained through the first three matches [24]. The length and work:rest ratio of the simulated match in this study resemble real wrestling competitions. It also resulted in the similar post-match plasma lactate concentrations to those in the literature [22, 58]. Therefore, it is possible that these well-trained wrestlers are adapted to this type of exercise and able to recover within 1 to 2 hours of rest. Furthermore, well-trained endurance athletes can also maintain the time to fatigue in intermittent exhaustive cycling exercise despite lower muscle glycogen levels [59]. Therefore, the well-trained wrestlers in this study may be able to maintain the performance in the three matches with or without the supplementation. Another unique characteristic of this study is that subjects consumed a carbohydrate-rich breakfast before the exercise began. In previous studies investigated the effect of ingestion of carbohydrate and protein (or amino acids) during post-exercise recovery, subjects were mostly at an overnight fasted state.

Colony counts were performed after incubation at 37°C in air for selleck chemicals llc 24 h. The number of colonies on plates containing H2O2 was compared with that on control plates and presented as bacterial survival (%). The assay was performed for 4 independent experiments. Sensitivity to killing by hydrogen peroxide was further examined in LB broth. An overnight culture of B. pseudomallei on Ashdown

agar was suspended in PBS and adjusted to approximately 1 × 108 CFU/ml. Ten microlitres of bacterial suspension was added into 1 ml of LB broth containing two-fold decreasing concentrations of H2O2 ranging from 500 to 31.25 μM. The mixtures were statically incubated at 37°C in air for 24 h and then the viable count and colony morphotype were determined by serial dilution and plating on Ashdown agar. The experiment

was performed for 2 independent experiments. Susceptibility of B. pseudomallei to reactive nitrogen intermediates (RNI) B. pseudomallei from an overnight culture on Ashdown agar was suspended find more in PBS and the bacterial concentration adjusted using OD at 600 nm. Thirty microlitres of bacterial suspension was added into 3 ml of two-fold decreasing concentrations of sodium nitrite (ranging from 10 to 0.1 mM) in LB broth at pH 5.0. The mixture was incubated at 37°C in air with shaking at 200 rpm and viable bacteria were determined at 6 h by serial dilution and plating on Ashdown agar. The number of viable bacteria in the presence of NaNO2 was compared with the number of bacteria in the inoculum and presented as bacterial survival (%). The experiment was performed in duplicate for 2 independent experiments. Susceptibility of B. pseudomallei to lysozyme and lactoferrin B. pseudomallei cultured overnight on Ashdown agar was harvested and suspended in 10 mM Tris-HCl buffer pH 5.0 [23]. The bacterial suspension was adjusted to a concentration of 1 × 107 CFU/ml. Fifty microlitres of bacterial suspension was added to an equal volume of 400 μg/ml chicken

egg white lysozyme (48,000 U/mg protein) (Sigma) to obtain a final concentration of 200 μg/ml. The mixture was incubated at Bay 11-7085 37°C in air for 24 h, after which 10 μl of 10-fold serial dilutions were dropped on Ashdown agar. Sensitivity to lysozyme was also tested in the presence of 3 mg/ml lactoferrin (Sigma) in a separate experiment [23]. E. coli strain HB101 was tested in parallel as a control. Susceptibility to human α-defensin and β-defensin B. pseudomallei was tested for resistance to HNP-1 and HBD-2 (Peptide international) as described previously [24], with the exception that HNP-1 was used at twice the dose. E. coli strain HB101 was tested in parallel as a control. Briefly, B. pseudomallei or E. coli strain HB101 colonies were washed and suspended in 1 mM sodium phosphate buffer pH 7.4 containing 1% TSB [24]. The bacterial suspension was adjusted to a concentration of 1 × 107 CFU/ml.

Lifestyle-related factors Self-reported lifestyle-related factors were measured both at baseline and at 1-year follow-up. Physical activity (PA) was measured in the baseline questionnaire by P005091 the short version of the international physical activity questionnaire (IPAQ), which assessed vigorous and moderate intensity PA (Craig et al. 2003). The average time spent on PA per day was calculated. Walking was not included in this calculation, since casual walking is regarded a light-intensity activity. For all behaviors, a dichotomous variable was calculated for non-compliance with the national recommendations. For insufficient

moderate PA, a cut-off point of <30 min of PA per day was used, and for insufficient vigorous PA, a cut-off point of <3 times a week vigorous PA. For insufficient fruit and vegetable intake, the cut-off point was <400 g of fruit and vegetables. Fruit and vegetable intake was measured with the nine-item validated Dutch Food Frequency Questionnaire (Bogers et al. 2004). Smoking was defined as current smoking status, and excessive alcohol use as drinking 15 or more glasses of alcohol per week

for women and 22 or more glasses for men. Health indicators Self-reported buy Batimastat health and body mass index (BMI) were measured at baseline and at 1-year follow-up. The first question of the short form-12 (SF-12) questionnaire was used to measure perceived general health and dichotomized into ‘poor or moderate’ and ‘good to excellent’ (Ware et al. 1996). In the physical health check, height and weight were measured to calculate the body mass index (BMI) and to categorize individuals as normal weight (BMI < 25 kg/m2), overweight (25 ≤ BMI < 30 kg/m2), and obese (BMI ≥ 30 kg/m2). In the first follow-up, weight was self-reported in the questionnaire. Work-related factors The self-reported work-related factors were measured in the baseline questionnaire. Participants were asked to indicate whether their current job is mainly physically or mentally demanding. In addition, Astemizole specific psychosocial and physical work demands were asked. The following psychosocial factors were measured with an abbreviated version of a validated Dutch questionnaire about psychosocial

job demands on job stress: work demands (6 items, Cronbach’s α = 0.82), job control (4 items, Cronbach’s α = 0.89), skill discretion (4 items, Cronbach’s α = 0.78), and support from colleagues (6 items, Cronbach’s α = 0.74) and supervisor (6 items, Cronbach’s α = 0.79) (Van Veldhoven and Meijman 1994). Questions on work demands were related to excessive work, and insufficient time to complete the work. Job control concerned influence on the planning of tasks, and influence on the pace of work. Skill discretion related to creativity, varied work, and required skills and abilities. Support from colleagues and supervisors was measured with questions related to conflicts, understanding, possibility to ask for help and to count on them, and the atmosphere.

In nymphs taking a blood meal, the expression of RpoS is highly induced, and then this global regulator, rather than the housekeeping σ70, likely transcribes dbpA. Additional studies are warranted to further elucidate the fine tuning of dbpBA expression, including the putative roles of the

IRs in dbpBA gene expression in ticks. Figure 4 qRT-PCR analysis of dbpA transcription in ticks and in mouse tissues. A, flat (uninfected) larvae, fed larvae, intermolt larvae, and fed nymphs during transmission phase were collected at 24-, 48-, and 72-h post-feeding. TT: tick transmission. B, mouse tissues of skin (S) heart (H), and bladder (B) were collected at various numbers of days (inset) after infection. Angiogenesis inhibitor The values represent the average copy

number normalized per 100 copies of B. burgdorferi flaB transcripts. Our data also revealed that dbpA transcripts were readily detected in mouse tissues at all times post-infection, including 7-, 14-, 21-, 28-, and 50-d (Figure 4B), suggesting that dbpA expression remains active during the entire mammalian phase of B. burgdorferi infection. These results are fully consistent with other reports using protein detection methods for Dbp assessment [63]. The finding that expression of both rpoS and dbpA, but not ospC, in the later BIX 1294 cell line phases of mammalian infection also is in agreement with a previous hypothesis [49] that repression of ospC may be mediated by a potential trans-acting repressor. Conclusions Since its initial discovery by Hubner et al. [19], the RpoN-RpoS pathway has been the subject of numerous studies seeking to understand core elements Resveratrol of regulatory control in B. burgdorferi [16–18, 20–33, 37, 43, 47, 49, 52, 56, 66]. What has emanated from this expanding body of work is that although certain

aspects of the pathway’s activation have been predictable, many emerging details have been counter intuitive. One of the unanticipated findings includes the discovery that BosR serves as an additional molecule essential for activation of the RpoN-RpoS pathway [28–31]. In this current study, we again obtained both anticipated and unanticipated experimental results surrounding the activation of the RpoN-RpoS pathway in ticks and during B. burgdorferi dissemination in mammalian tissues. Our data indicate that the transcription levels of ospC, dbpA, ospA, or rpoS were variable among mouse samples at different times post-infection. One potential explanation for this is that these important genes are indeed transcribed at different levels within these tissues. Alternatively, it is also possible that our results emanated from low spirochete burdens in these tissue samples, as indicated by the relatively low levels of flaB transcripts detected in these same samples (data not shown). Indeed, the low numbers of spirochetes in certain mouse tissue samples limited our cDNA yields.

PFOR and/or PDH (iv) Aldh and AdhE, and (V) bifurcating, Fd-dependent, and NAD(P)H dependent H2ases, that can be used for streamlining H2 and/or ethanol producing capabilities in sequenced and novel isolates. By linking genome content, reaction thermodynamics, and Trichostatin A concentration end-product yields, we

offer potential targets for optimization of either ethanol or H2 yields via metabolic engineering. Deletion of LDH and PFL could potentially increase both H2 and ethanol yields. While deletion of ethanol producing pathways (aldH, adh, adhE), increasing flux through PFOR, overexpression of Fd -dependent H2ases, and elimination of potential H2-uptake (NAD(P)H-dependent) H2ases could lead to increased H2 production, eliminating H2 production and redirecting flux through PDH would be beneficial for ethanol production. Although gene and gene-product expression,

functional characterization, and metabolomic flux analysis remains critical in determining pathway utilization, insights regarding how genome content affects end-product yields can be used to direct metabolic engineering strategies and streamline the characterization of novel species with potential industrial applications. Acknowledgements This work was supported by funds provided by the Natural Sciences and Engineering Research Council of Canada (NSERC), through a Strategic Programs grant this website (STPGP 306944–04), by Genome Canada, through the Applied Genomics Research in Bioproducts or Crops (ABC) program for the grant titled, “Microbial Genomics for Biofuels and CoProducts from Biorefining Processes”, and by the Province of Manitoba, Agricultural and Rural Development Initiative (ARDI), grant 09–986. Electronic supplementary material Additional

file 1: Cofactor specificity (ATP or PP i ) of phosphofructokinases based on sequence alignments. Alignments of key residues determining ATP or PPi specificity, as determined by Bapteste et al. [74] and Bielen et al. [75], were performed using BioEdit v.7.0.9.0. The P. furiosus and Th. kodakarensis genes are very distinct (different COG and different KO) and are annotated as Archaeal phosphofructokinases. aminophylline (PDF 178 KB) Additional file 2: Phylogenetic clustering of [NiFe] hydrogenases large (catalytic) subunits. Catalytic (large) subunits of [NiFe] H2ases were identified based upon the modular signatures as described by Calusinska et al. [16], Species considered in this manuscript are highlighted and corresponding H2ase gene loci are provided. (PDF 247 KB) Additional file 3: Phylogenetic clustering of [FeFe] hydrogenases large (catalytic) subunits. Catalytic (large) subunits of [FeFe] H2ases were identified based upon the modular signatures as described by Calusinska et al. [16]. Species considered in this manuscript are highlighted and corresponding H2ase gene loci are provided. (PDF 476 KB) References 1.

For full resistance to the streptogramine combination quinupristin-dalfopristin, strains need to carry additional resistance to streptogramin A compounds, which may be mediated by acetylation Metabolism inhibition (acetyl transferase genes vat(A), vat(B) and vat(C), or by putative efflux pumps encoded by vga(A) and vga(B)[5, 6]. Tetracycline resistance in staphylococci is either based on the expression of a ribosomal protection factor encoded by the widely disseminated tet(M) gene or mediated by tet(K)

mediated efflux of the antibiotics [7]. For aminoglycoside resistance, the presence of aminoglycoside – modifying enzyme genes aac(6′)-aph (2″), aph(3′)-IIIa and ant(4′)-Ia has been analysed. The most frequently encountered gene in staphylococci

is the aac(6′)-aph(2″) which codes for a bifunctional enzyme and confers resistance to gentamicin, tobramycin, kanamycin and when over-expressed to amikacin but not to streptomycin [8]. For the quinolones such as ciprofloxacin and pefloxacin, a main mechanism of resistance is the spontaneous accumulation of mutations in the genes encoding subunits of the DNA gyrase (gyrA and parC) [9]. Other important antimicrobials include chloramphenicol and co-trimoxazole (trimethoprim + sulphamethoxazole). Resistance to chloramphenicol is mainly mediated by the catA gene which is responsible for the chloramphenicol acetyl Temsirolimus transferase while co-trimoxazole resistance is due to mutations of the enzyme dihydrofolate reductase encoded by the dhfr gene [10]. Methicillin resistance in staphylococci is mainly due to the expression of the mecA gene, which specifies penicillin binding protein 2a (PBP2a), a transpeptidase with a low affinity for β-lactams

[11]. mecA is located on a 21-to 67-kb mobile genetic element (MGE) called Staphylococcal Chromosome Cassette mec (SCCmec) [11, 12]. Different SCCmec elements in staphylococci have been classified and characterized according to the combination of two parts: the ccr complex and the mec complex. Cassette chromosome recombinase (ccr) genes (ccrC or the pair of ccrA and ccrB) encode recombinases that mediate integration and excision of SCCmec into and from the chromosome [12–14]. The ccr gene(s) form the ccr gene complex. The mec gene complex on the other hand, consists of mecA, mecR1 and mecI regulatory ADAMTS5 genes and associated insertion sequences and has been classified into six different classes: A, B, C1, C2, D and E [13, 14]. The regions located between these complexes are called J (joining) regions. In every SCCmec elements there are three of these regions (J1-J3) and polymorphisms in the regions are used for the definition of SCCmec type IV subtypes [15]. In addition to ccr and mec gene complexes and J regions, SCCmec contains a few other genes or pseudogenes that does not appear to be essential to the bacterial cell with exceptions including various other MGE, e.g.