00 kcal/mol), which may explain

lower sensitivities of pCS20 LAMP than sodB LAMP. As is documented in several reports [24, 36], LAMP showed relative tolerance to PCR inhibitors in blood, which was comparable to pCS20 real-time PCR (Table 2). However, LAMP was clearly inhibited when DNA extracts from A. variegatum were included in the reaction (Table 2). It is known that Amblyomma tick tissue contains PCR-inhibitory elements which cannot be always removed during DNA purification [14, 15]. Thus, LAMP is slightly less sensitive in the presence of such inhibitors in ticks compared to real-time PCR. However, considering that real-time PCR is time-consuming and requires a thermal cycler with real-time monitoring and data analysis systems, which is expensive and can be relatively complicated to use, LAMP has clear advantages over real-time PCR in terms of a practical system in a standard diagnostic laboratory, especially CP673451 nmr those in developing countries where the disease is prevalent. In the present study, two sheep blood samples from

a heartwater-endemic area tested positive by LAMP (Table 3). Domestic ruminants are known to occasionally harbor E. ruminantium without any clinical signs and to serve as reservoirs of the disease after recovery [37]. Previous reports demonstrated that PCR assays could detect the pathogen in the peripheral blood of clinically healthy AZD5582 animals in heartwater endemic areas [20, 38], indicating that a DNA-based technique is useful even for the diagnosis of latent infection. Hence, LAMP ON-01910 molecular weight is a powerful tool not only for the epidemiological study of heartwater but also for the rapid and sensitive diagnosis of infected animals in the disease-endemic areas. The simplest way of detecting Tolmetin LAMP products is to inspect the white turbidity that results from magnesium pyrophosphate accumulation, as a by-product of the reaction, by naked eye [29]. However, a small amount of this white precipitate is not always distinguishable from other white precipitates, such as proteins or carbohydrates,

derived from the templates. As an alternative method, this study employed a closed system, coupled with a double-stranded DNA (dsDNA)-binding dye, for low-cost detection of amplified DNA (Figure 1C and 1D, lower panels). The results obtained by this system were consistent with those obtained by gel electrophoresis (Figure 1C and 1D, upper panels). Since the detection can be accomplished in a closed system, without opening the reaction tubes, the risk of contamination is much lower than in gel electrophoresis or by adding dye at the end of the reaction. Theoretically, it should be possible to replace the Gel-Red TM dye we used with other dyes such as SYBR Green I [22, 25, 39], ethidium bromide, EvaGreen [30], and PicoGreen [40], which are reported to be useful for the detection of LAMP products. As well documented by Burridge et al.

In 2001, the Health Council reviewed several screening test methods. A triple test to be offered in

the second trimester of pregnancy was considered as a suitable risk assessment screening for both Down syndrome and neural tube defects and should be aimed at all pregnant women, regardless of age. According to the Heath Council, when certain conditions were met, such as an adequate procedure for informed consent, risk assessment Staurosporine clinical trial for Down syndrome would be ‘such a superior alternative to the existing practice of maternal age-based screening that there should be no reason to delay its introduction any longer’. The Council argued that screening www.selleckchem.com/products/BIBW2992.html based on the triple test would lead to considerably fewer invasive tests and increased detection of Down syndrome pregnancies, while a far larger group would be allowed to benefit from having individual risk assessment. The introduction of screening for neural tube defects was considered a desirable step (Health Council of the Netherlands 2001, 28–29).

At the end of 2001, the Ministry of Health organised a Consultation round inviting several groups, such as obstetricians and patient representatives, to voice their opinions on serum screening (Toom and van Berkel 2003). In the same year, several obstetricians criticised the Health Council’s report in a medical journal. An important point of contention was that the birth prevalence of Down syndrome was higher in the maternal age group over 36 years of age. According to these obstetricians, by setting an age limit, potential psychological harm from screening younger women could be prevented (Hamerlynck and Knuist 2001). Another argument was that test characteristics

for the group of older women were better than for the group of younger women. The number of false negatives in women under 36 years of age was found unacceptably high: approximately half of the cases of Down syndrome in pregnancies of younger women would not be detected, thereby giving false reassurance. In addition, the false positives in the younger age group would require further Phosphatidylinositol diacylglycerol-lyase testing. Based on figures from the Health Council, the obstetricians calculated that via invasive testing about the same number of cases of Down syndrome would be detected (115) as healthy foetuses would be lost because of test-induced iatrogenic abortions (111). Medicalisation of pregnancy was deemed undesirable (Kleiverda and Vervest 2001). The Health Council Committee had based its arguments on calculations for all age Akt inhibitor groups together. Representatives of the Committee responded by stating that compared to the current age-related diagnostic testing, the total number of invasive tests would drop.

The biosynthesis of astaxanthin

from the isoprenoid precursor geranylgeranyl pyrophosphate (GGPP) in X. dendrorhous requires at least four enzymatic activities, which are catalyzed by enzymes encoded by the genes crtI, crtYB and crtS. During the first phase H 89 manufacturer of biosynthesis, the phytoene synthase activity of the bifunctional enzyme phytoene-β-carotene synthase (PBS, product of crtYB) catalyzes the condensation of two GGPP molecules to produce one molecule of phytoene, the first carotenoid of the pathway [5]. After four desaturation reactions catalyzed by the enzyme phytoene desaturase (product of crtI), phytoene is transformed into a lycopene [6]. Subsequently, the lycopene is cyclized to BV-6 datasheet form β-carotene via the

β-carotene synthase activity of PBS [5]. Finally, the β-carotene is oxidized at both ends in a process that requires cytochrome p450 astaxanthin synthase (product of crtS) [7, 8]. This reaction requires the accessory activity of a cytochrome p450 reductase enzyme as an electron donor [9]. Although the structural genes needed for the synthesis of astaxanthin in this yeast have been characterized, the regulatory mechanisms that control this process are largely unknown. Importantly, alternative processing of crtYB and crtI have been reported to occur [10], although the implications of this phenomenon have not been established. In addition, alternative Histone demethylase transcripts of both genes have several premature stop codons in all three reading frames, and they likely encode non-functional proteins [10]. X. dendrorhous can develop two metabolic modes depending on the type of carbon source present in the medium. Glucose

or other fermentable Inhibitor Library clinical trial sugars are assimilated through the glycolytic pathway followed by alcoholic fermentation to produce ethanol, even in the presence of oxygen [11]. However, non-fermentable carbon sources, such as ethanol or succinate, are transformed to acetyl-CoA and are processed through the citric acid cycle. Thus, energy is produced mainly through oxidative phosphorylation. There is a strong correlation between the carbon source used and the level of pigment synthesized; high glucose concentrations as the carbon source yield minimal pigment synthesis [12, 13], ethanol as the carbon source yields greater pigment synthesis [14]. In addition, when X. dendrorhous is grown on glucose as the only carbon source, the induction of carotenogenesis coincides with sugar depletion and the beginning of ethanol consumption (produced by fermentation of the carbohydrate) [15]. Finally, previous studies have reported the presence of putative MIG1 binding sites in the promoter regions of the crtYB, crtI and crtS genes [7]. MIG1 was originally described in S. cerevisiae and is a well-known transcription factor that mediates glucose-driven transcriptional repression processes in various yeasts [16–19].

Pseudohaliea rubra CM41_15aT was deposited in the DSMZ by the Laboratoire Arago, Université Pierre et Marie Curie (Banyuls-sur-Mer, France) under the conditions of a Material Transfer Agreement. For routine cultivation all strains were grown in SYPHC medium at 28°C [15]. Replacing of pyruvate in SYPHC medium with 10 mM DL-malate

resulted in SYMHC medium. SYM medium was obtained, if the supplementary amino acids L-histidine and L-cysteine were omitted. The preparation of defined media for growth on single carbon sources and the generation of various gas atmospheres in batch cultures has been described elsewhere [15, 18]. A 40 W incandescent bulb was click here used as light source for the determination of growth curves in the light. For the illumination of cultures with light of distinct Selleckchem MK-4827 wavelengths LED lamps were used emitting blue,

green and red visible light with peak wavelengths of 627, 518 and 466 nm, respectively. All used chemicals were obtained from Sigma-Aldrich (Taufkirchen, Germany) and complex nutrients from DIFCO BBL (Becton Dickinson; Heidelberg, Germany). Determination of growth, cellular pigmentation and cytochromes The absorbance values of growing cultures were determined in a Thermo Scientific BioMate 6 split beam UV/visible spectrophotometer CB-5083 using 1 cm light path disposable cuvettes and water as blank. The A660nm reading was used to estimate the cell density. The cellular dry weight of grown cultures was determined by overnight freeze-drying of cell pellets harvested by centrifugation. Expression of the light-harvesting complex in L. syltensis was estimated by determining the A870nm to A660nm ratio, for cultures of C. litoralis and C. halotolerans a ratio of A880nm to A660nm was used and for P. rubra a ratio of A820nm to A660nm. Photosynthetic pigments were extracted from wet cell pellets Thalidomide using a mixture of

acetone/methanol (7:2) as described previously [15]. The concentrations of bacteriopheophytin a, bacteriochlorophyll a and spirilloxanthin in the acetone/methanol extracts were determined from the absorbance values obtained at 747, 771 and 475 nm, respectively, using the spectral reconstruction method of van der Rest and Gingras [31]. The detection and identification of various cytochrome types was done as reported previously [15]. Semiquantitative detection of transcripts using PCR RNA was isolated from cultures of C. litoralis DSM 17192T that were grown to early stationary phase under various incubation conditions. A culture volume equivalent to a cell suspension of one ml with an A660nm of approx. 1.0 was diluted with two volumes of RNAprotect Bacteria Reagent (Qiagen; Hilden, Germany), then cells were harvested by centrifugation.

Study population and method Design The study design is a RCT, reported according to the CONSORT Statement for Reporting Randomized Trials: Explanation and Elaboration (Altman et al. 2001). Female HSOs workers on long-term (>60 days’) sick leave and with chronic pain in the neck region were randomized into three groups, namely, myofeedback training, intensive muscular strength training, or control group. The same measurements were repeated, by the same research nurses at a university hospital clinic,

1 and 3 months after start of the intervention. The study was approved by the ethical committee at GSK458 the University of Gothenburg and performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments. All participants gave their informed consent prior to inclusion in the RCT. Sample The study group consisted of municipality-employed women 35–60 years old with work disability

and pain in the neck region for at least 1 year. The inclusion criterion was that the reduction in working degree should be at least 50% and be due mainly to the diagnoses cervicobrachial pain syndrome (International Classification of Diseases, 10th revision, ICD 10, code M53.1) or cervical pain syndrome (ICD 10-code M54.2), as judged by the treating physician. The work disability was defined as the employed PI3K inhibitor woman being on total or partial (>50%) sick leave from work for at least 60 days before inclusion. There was no exclusion due to ongoing rehabilitation measures. Criteria for exclusions were the following: systemic inflammatory diseases, malign diseases and progressive neurologic diseases, psychosis, non-medically treated depressions, and diseases that do not allow hard muscular training. The participants were www.selleckchem.com/products/SB-202190.html selected from a cohort, started in August 2005, of female (35–65-year-old) HSOs employed by one of Sweden’s three metropolitan cities (Ahlstrom et al. 2010). Half of the councils within

the region, representing various socioeconomic statuses were consecutively invited to the study. All female employees on long-term sick leave (n = 633) received written information about the study. mafosfamide Only one reminding letter was sent to non-respondents. In addition, human resource professionals could invite known employees which they thought met the inclusion criteria (n = 60). Only 12 of them fulfilled the inclusion criteria. Of those assessed for eligibility, 82% participated throughout the study. Of all respondents in the cohort, 54% (n = 175) had chronic pain in the neck region (>30% out of 100% of the Von Korff index) (Von Korff et al. 1992) and 48% (n = 154) reported having a diagnosed musculoskeletal disorder. The first respondents showing willingness to participate in the RCT study were contacted by phone and informed about the study.

(ZIP 3 MB) Additional file 7: Table S7. Statistically significantly

differentially expressed probe sets in the gingival tissues eFT508 according to levels of P. micra in the adjacent pockets. (ZIP 3 MB) Additional file 8: Table S8. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of C. rectus in the adjacent pockets. (ZIP 3 MB) Additional file 9: Table S9. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of E. corrodens in the adjacent pockets. ALK inhibitor (ZIP 3 MB) Additional file 10: Table S10. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of V. parvula in the adjacent pockets. (ZIP 3 MB) Additional file 11: Table S11. Statistically significantly differentially expressed probe sets in the gingival tissues according to levels of A. naeslundii in the adjacent pockets. (ZIP 3 MB) Additional file 12: Table S12. A list of the top 100 differentially expressed probe sets in the gingival tissues according to levels of ‘Etiologic burden’ in the adjacent pockets. (XLS 32 KB) Additional file 13: Table S13.

A list of the top 100 differentially expressed probe sets in the gingival this website tissues according to levels of ‘Putative burden’ in the adjacent pockets. (XLS 26 KB) Additional file 14: Table S14. A list of the top 100 differentially expressed probesets in the gingival tissues according to levels of ‘Health-associated burden’ in the adjacent pockets. (XLSX 17 KB) Additional file 15: Table S15. List of all statistically significantly regulated GO groups in the gingival tissues according to levels of each of the 11 investigated species in the adjacent pockets. (ZIP 646 KB) References 1. Socransky SS, Haffajee AD: Periodontal microbial ecology. Periodontol 2000 2005, 38:135–187.CrossRefPubMed 2. Marsh PD: Dental plaque: biological significance of a biofilm and community lifestyle. J Clin Periodontol 2005,32(Suppl 6):7–15.CrossRefPubMed 3. Listgarten MA, Helldén Ureohydrolase L: Relative distribution of bacteria at clinically healthy and periodontally diseased sites in humans. J Clin Periodontol

1978,5(2):115–132.CrossRefPubMed 4. Socransky SS, Haffajee AD, Smith C, Dibart S: Relation of counts of microbial species to clinical status at the sampled site. J Clin Periodontol 1991,18(10):766–775.CrossRefPubMed 5. Page RC, Schroeder HE: Pathogenesis of inflammatory periodontal disease. A summary of current work. Laboratory investigation; a journal of technical methods and pathology 1976,34(3):235–249.PubMed 6. Offenbacher S: Periodontal diseases: pathogenesis. Ann Periodontol 1996,1(1):821–878.CrossRefPubMed 7. Chung CH, Bernard PS, Perou CM: Molecular portraits and the family tree of cancer. Nat Genet 2002,32(Suppl):533–540.CrossRefPubMed 8. Quackenbush J: Microarray analysis and tumor classification. N Engl J Med 2006,354(23):2463–2472.CrossRefPubMed 9.

schenckii sssod, ssnramp, sssit and ssgapdh gene homologues Emricasan mouse were obtained using XAV939 RLM-RACE (Applied Biosystems, Foster City, CA, USA) with S. schenckii cDNA as template. All RACE reactions were carried out in the ABI PCR System 2720 (Applied Biosystems). The touchdown PCR and nested PCR parameters used for the initial RACE reactions were the same as described previously [26]. Nested primers were designed

to improve the original amplification reactions. Bands from the 5′ nested PCR were excised from the gel and cloned as described above. Primers for RACE were designed based on the sequence obtained from the yeast two-hybrid assay. For the initial 5′ RACE of sssod gene the following primers were used: GSP-UTR-1(rev) 5′ actcttctggctgtcaccgtccccgtc 3′; NGSP-UTR-2 (rev) 5′ cgccgtccgtcctatgtcttcaacttc 3′; GSP-AWTQHMTLNL (rev) 5′ ggttgagcatcagggtcatgtgctgcgtccaggc 3′; NGSP-RSIHHLPV (rev) 5′ gacacgggcaggtggtgtatgctgcgg PD-1/PD-L1 targets 3′; GSP-HNTDFFFKH (rev) 5′ tgcttgaagaagaagtcggtgttgtgg 3′ and NGSP-TTYEDREL (rev) 5′ ctcttgagctcgcggtcctcgtatgtggtgc 3′. For PCR the primers used were: forward primer WTQYMTL (fw) 5′ ttggacccagtacatgaccctgat 3′ (obtained from the published sequence of the G.

zeae sod gene, GenBank accession no. XP_387245.1) and lower primer HVWLRDYG (rev) selleck chemical 5′ agcccgtagtcccgcagccacacgtg 3′. For RTPCR the following primers were used: MFRPR (fw) 5′ gcaccatgttccgtccgagg 3′ and PSLWKQP (rev) 5′ ctgcttccacaggctcgggt 3′. For 5′ RACE of ssnramp gene the following primers were used: GSP-TASSTSTSDI (rev) 5′ ccaatgtcgctcgtactgctcgctgtc 3′; NGSP-TSFDKYMT (rev) 5′ cggtcatgtacttgtcaaacgatgtga 3′; NGSP-VVEVAVSLF (rev) 5′ aaagagcgagacggcgacctcaacaac 3′; GSP/NGSP-LSMIDHTT (rev) 5′ tgtggtgtggtcaatcatggacagc 3′ and NGSP-WKVVSSLR (rev) 5′ cctaagactagagacgaccttccag 3′. The complete cDNA coding sequence of ssnramp was confirmed

using RTPCR with cDNA as template and the following primers: UP-1(fw) 5′ tgttcactacttgggctgt 3′ and LW-1 (rev) 5′ gcttgtgttagttgcccttg 3′. For 5′ RACE of the sssit gene, the following primers were used: GSP-SVVTLFASV (rev) 5′ gacggaagcaaagagtgtaacgacaga 3′; NGSP-SLRKYDFND (rev) 5′ tcattgaagtcgtactttcgtaaggat 3′; GSP/NGSP-QLIFCLSS (rev) 5′ gggatgaaaggcagaatatgagctgcg 3′; GSP/NGSP-LIHRTTHR (rev) 5′ tcggtgtgtggtacggtggattaac 3′; GSP-LEWRGFFS (rev) 5′ cgctgaagaagccacgccattccaatg 3′; GSP-TESPKGHE (rev) 5′ ctcgtgccctttaggagattccgt 3′ and NGSP-STHPAD (rev) 5′ gatcatctgcgggatgtgtagaca 3′. The complete cDNA coding sequence of the sssit gene was confirmed using RTPCR. cDNA was used as template for RTPCR and the following primers: UP-Sit (fw) 5′ ttcaatacagcataacgccactgatc 3′ and LW-Sit (rev) 5′ aaaacagtgttccgtacttactacta 3′.

21. Swofford DL: PAUP: Phylogenetic analysis

using parsimony (and other methods), Version 4. Sunderland, MA: Sinauer Associates 1998. 22. Kumar S, Tamura K, Nei M: MEGA3: Integrated www.selleckchem.com/products/cbl0137-cbl-0137.html Software for Molecular Evolutionary Genetics Analysis and Sequence Alighnent. Briefings in Bioinformatics 1994, 5:150–163.CrossRef Authors’ contributions TSS: Conception, acquisition and analysis of data, interpretation of data, drafting of manuscript, approved final draft. RTO: Analysis and selleck chemicals llc interpretation of data, drafting of manuscript, approved final draft, BW: Acquisition and interpretation of isolate data, approved final draft, RE: Acquisition and interpretation of DNA signature data, approved final draft, LYH: Acquisition and interpretation of DNA signature data, approved final draft, Buparlisib in vivo JMUR: Acquisition and interpretation of DNA signaturedata, approved final draft, MD: Acquisition and interpretation of DNA signature data, approved final draft, SRZ: Acquisition and interpretation of DNA signature data, approved

final draft, LJK: Provide insight for relationship between worldwide and Chinese isolates, approved final draft, JB: Acquisition and interpretation of data, approved final draft, JMS: Acquisition and interpretation of data, approved final draft, TP: Input on phylogenetic analysis of datasets, draft manuscript, approved final draft, DMW: Provide insight into geographical relationships between worldwide isolates, draft manuscript, approved final draft, AH: Provide data and genotyping

information for new Texas isolates belonging to Ames sub-lineage, approved final draft, JR: Initial sequencing, assembly and analysis of genomes, approved final draft. PK: Responsible for concepts, vision and direction for the entire project, draft manuscript, approved final draft.”
“Background Environmental contamination from domestic and industrial waste discharges has become a major public health concern. Wastewater treatment processing includes a final disinfection stage which eliminates pathogenic microorganisms (bacteria, virus and protozoa). Water disinfection can be achieved using chlorine, chlorine dioxide, hypochlorite, ozone or ultraviolet radiation. Although very efficient against a large clonidine range of microorganisms, the implementation of these solutions for wastewater treatment has been limited by environmental factors, namely the formation of toxic by-products from chorine [1], or by economic factors, as ultraviolet radiation and ozone treatment that are very expensive options to apply. Thus, as water reuse may be a way to cope with low water availability [2] in densely populated areas, more convenient and inexpensive technologies of water disinfection are needed [3]. Photodynamic antimicrobial therapy has recently been used to efficiently destroy microorganisms.

In the example of Fig. 6, the pulse-modulated ML was triggered with 100 kHz pulse-frequency at 100 μs before onset of 440 nm AL. At 1 ms after onset of AL, a saturating 50-μs multi-color ST pulse was applied. The ST pulse closes PS II reaction centers transiently, so that the I 1-level of fluorescence yield can be determined by extrapolation to 1,050 μs. I 1 corresponds to the maximal fluorescence yield that can be reached in the presence of an oxidized PQ-pool (for apparent PQ-quenching see Samson et al. 1999; ICG-001 Schreiber 2004). Weak FR background light or short FR-preillumination

is routinely applied to assure a fully oxidized PQ-pool. This aspect is particularly important in the study of algae and cyanobacteria, where depending on conditions the PQ-pool Tipifarnib mw becomes more or less reduced in the dark via NADPH-dehydrogenase activity, resulting Fer-1 concentration in more or less transition into state 2. Furthermore, FR-preillumination minimizes the contribution of “inactive PS II” to the O–I 1 kinetics. Fig. 6 Initial increase of fluorescence yield (O–I 1 rise) in a dilute suspension of Chlorella (300 μg Chl/L) induced

by 440-nm AL with 2,131 μmol quanta/(m2 s) in presence of FR background light. Dashed yellow lines indicate F o-level (O), assessed during a 50-μs period preceding onset of AL at time zero, and the I 1-level that is determined with the help of a saturating single-turnover pulse (ST) triggered 1 ms after onset of AL (see Fig. 2 for the Fast Kinetics trigger pattern). The slope of the relaxation kinetics is extrapolated to the end of the 50-μs ST. The black line represents the O–I 1 fit curve based on a PS II model which incorporates energy transfer between PS II units and reoxidation

of the primary PS II acceptor QA (see text) At a first approximation, assuming that the AL-driven increase of fluorescence yield is linearly correlated with accumulation of Q A − , and that the initial rise is negligibly slowed down by Q A − reoxidation, the kinetics can be described by a first order reaction, of which the time constant Tau = 1/k(II) corresponds to the time for reaching a QA-reduction level of 100(1 − 1/e) = 63.2 %. When this approximation is applied to the O–I 1 rise Interleukin-3 receptor of Fig. 6, Tau = 0.379 ms is estimated. A thorough analysis of the O–I 1 rise kinetics, however, has to take into account both Q A − reoxidation and nonlinearity between ∆F and the fraction of reduced Q A. This can be achieved by a fitting routine we have specially developed for this purpose (see “Materials and methods”). For the O–I 1 rise displayed in Fig. 6, which was driven by 2,131 μmol quanta/(m2 s) of 440-nm AL, the following values were estimated by the O–I 1 fit routine: Tau = 0.173 ms, k(II) = 1/Tau = 5.78 × 103/s, Tau(reox) = 0.340 ms, J = 2.01 (corresponding to p = 0.67), Sigma(II)440 = 4.51 nm2.

Therefore, it is possible that these athletes already had higher basal concentration of NO than general population and certain patients [53]. Thus, arginine supplementation did not provide any additional effect on NO

production in our subjects. The lack of effect of carbohydrate supplementation, with or without BCAA and arginine, on the performance of high-intensity intermittent exercise is in contrast to previous studies in which low muscle glycogen content contributed to the development of fatigue in such type of exercise [2, 4, 54, 55]. Although muscle biopsy was not performed, the exercise protocol used in our study would significantly CH5183284 manufacturer reduce the glycogen content in the working muscles. It has been shown that Proteasome structure a single bout of 30-s all-out cycling reduced muscle glycogen by approximately 24% [56]. In addition, muscle glycogen selleck chemicals llc levels were decreased by 19.6-36.4% after 10 to 15 bouts of 6-s

all-out cycling, interspersed with 30-s rests [2, 57]. Therefore, the decrease in muscle glycogen after our simulated matches would be similar, or even larger, than that in real wrestling matches [22]. Even though the glycogen content in the working muscles would be significantly decreased after two simulated matches in our study, the performance in match 3 was not significantly different from the previous two matches in all 3 trials. One possible explanation is that these experienced wrestlers have the ability to recover quickly from

the previous matches. In agreement, it has been reported that grip strength, isometric upper body pull strength, hip and back strength, vertical jump, and isokinetic knee extension peak torque were all generally maintained throughout a 2-day, 5-match freestyle wrestling tournament [23]. A recent study on a 1-day 5-match Greco-Roman much wrestling tournament also revealed that these parameters were generally maintained through the first three matches [24]. The length and work:rest ratio of the simulated match in this study resemble real wrestling competitions. It also resulted in the similar post-match plasma lactate concentrations to those in the literature [22, 58]. Therefore, it is possible that these well-trained wrestlers are adapted to this type of exercise and able to recover within 1 to 2 hours of rest. Furthermore, well-trained endurance athletes can also maintain the time to fatigue in intermittent exhaustive cycling exercise despite lower muscle glycogen levels [59]. Therefore, the well-trained wrestlers in this study may be able to maintain the performance in the three matches with or without the supplementation. Another unique characteristic of this study is that subjects consumed a carbohydrate-rich breakfast before the exercise began. In previous studies investigated the effect of ingestion of carbohydrate and protein (or amino acids) during post-exercise recovery, subjects were mostly at an overnight fasted state.