Despite intensive

investigations on the properties of ZnO, little is known about its surface properties. While a few claim that the Fermi level is pinned above the conduction band edge [26], others claim that the Fermi level is pinned below the conduction band edge [27]. Here, we take the Fermi level to be located below the conduction band edge as in the case of n-type ZnO NWs [28]. This is also in accordance with Long et al. [23] who suggested that Zn3N2 with Seliciclib purchase N substituted by O (ON) is more stable than Zn replaced by O (OZn) or interstitial O (OI). In the case of ON, the Fermi level locates near the bottom of the conduction band, but in the cases of both OZn and OI, the Fermi level is pinned around the top of the valence band [23]. In other words, interstitial oxygen gives p-type Zn3N2, but since it is not energetically favourable, we expect to have the formation of n-type ZnO shell at the surface which surrounds an n-type Zn3N2 core. The energy band diagram

of a 50-nm diameter Zn3N2/ZnO core-shell NW determined from the self-consistent solution of the Poisson-Schrödinger equations (SCPS) in cylindrical coordinates and in the effective mass approximation click here is shown in Figure  4. In such a calculation, Schrödinger’s equation is initially solved for a trial potential V, and the charge distribution ρ is subsequently determined by multiplying the normalised probability density, ∣ψ k ∣2, by the thermal occupancy of each sub-band with energy E k using Fermi-Dirac statistics and summing over all k. The Poisson equation is then solved for this charge distribution

in order to find Mephenoxalone a new potential V′, and the process is repeated until convergence is reached. A detailed description of the SCPS solver is given elsewhere [29, 30]. In this calculation, we have taken into account the effective mass m e * = 0.29 mo and static dielectric constant ϵ r = 5.29 of Zn3N2[24, 31], as well as m e * = 0.24 mo and ϵ r = 8.5 for ZnO [32, 33]. In addition, we have taken into account the energy band gap of Zn3N2 to be 1.2 eV [17, 24] and the Fermi level to be pinned at 0.2 eV below the conduction band edge at the ZnO surface [28]. A flat-band condition is reached at the centre of the Zn3N2/ZnO NW, and a quasi-triangular potential well forms in the immediate vicinity of the surface, holding a total of eight sub-bands that fall below the Fermi level. The one-dimensional electron gas (1DEG) charge distribution is confined to the near-surface region, has a peak density of 5 × 1018 cm−3 (≡5 × 1024 cm−3), as shown in Figure  4, and a 1DEG line density of 5 × 109 m−1. Optical transitions in this case will occur between the valence band and conduction band states residing above the Fermi level similar to the case of InN [1].

The 18 Da increase in mass was selleck attributed to the hydrolysis of a lactone. This result indicated that the two compounds were cyclic lipopeptide antibiotics. The MS/MS spectrum

of the doubly charged precursor ion of the hydrolyzed compound at m/z 567.4 with a mass of 1133 Da was shown in Figure 1. Successive fragmentations from the two termini of the ring-opened lipopeptide resulted in b-type ions at m/z 1014.3, 901.2, 802.1, 702.1, 589.1, 441.9, 341.9, and 228.8, along with corresponding y-type ions detected at m/z 905.2, 792.1, 692.0, 544.9, 431.9, 331.6, and 232.7. These fragment ions allowed for the assignment of the following sequence: Ile/Leu-Dab-Phe- Leu/Ile-Dab-Val-Leu/Ile-Thr-OH. The b-type ions at m/z 228.8 corresponded to fatty acid (FA)-Dab, which indicated that the fatty acyl moiety has the elemental composition of C7H12O2. Figure 1 MS/MS spectrum of PE1 and its proposed amino acid sequence. (A) MS/MS spectrum of the doubly charged precursor ion at m/z 567.4 of the

hydrolyzed PE1 of 1,133 Da. (B) Proposed amino acid sequence of PE1. The ring-opened PE2 with a mass [M + H]+ of 1,119 Da was also analyzed by CID. The tandem mass spectrum of this Torin 1 derivative was shown in Figure 2. All of the b-type ions that were generated from this doubly charged precursor ion [M + 2H]2+ at m/z 560.3 were 14 Da less than those generated from the precursor ion [M + 2H]2+ at m/z 567.4. However, the two y-type ion series for the two compounds were almost the same in mass, which indicated that the two compounds had identical amino acid sequences but different fatty acid chains. Similar to PE1, PE2 also produced a fragment ion at m/z 905.1, which corresponded

to the loss of 214 Da from the [M + H]+ ion. Examination of the neutral fragment that was lost suggested that it contains a Dab residue and a fatty acyl moiety (C6H10O2). These results further confirmed that the two compounds were different in their fatty acyl moieties. Figure 2 MS/MS spectrum of PE2 and its proposed amino acid sequence. (A) MS/MS spectrum of the doubly charged precursor ion at m/z 560.3 of the hydrolyzed PE2 of 1,119 Da. (B) Proposed amino acid sequence of PE2. Apart from in the C-terminal amino acid (Thr), no hydroxyl group was found in the peptide moieties of P. ehimensis lipopeptides studied here. Thus, a lactone linkage was else only formed between the carboxyl group of the C-terminal and the hydroxyl group of fatty acid moieties. The proposed structures for PE1 and PE2 are showed in Figure 3. Figure 3 Proposed structures of PE1 and PE2 produced by Paenibacillus ehimensis B7. Antimicrobial activities of the purified compounds The antimicrobial activities of the purified compounds PE1 and PE2 were measured using micro dilution methods. Table 1 showed that PE1 and PE2 both had a similar level of strong activity against all of the tested Gram-positive and Gram-negative pathogens as well as Candida albicans.

Table 2 qRT-PCR primers GAPDH S: ATTGGGCGTATTGTCTTCC AS: TTGAGCATGTAGGCAGCATA MAT1-1-1 S: TTCGTTCATAGCCTTCAGAAGCTTC AS: GGCCAGCATGACTGTCACGAAT PPG1 S: CTGTGTGGGCAGTAGCAATTCC AS: CAACGTTTCGCGACGAATTCA STE2 S: TGCTCTCGTTACTCGCAGAC AS: ATTGGATTATTGAGAAAATGGCTGGAATC Z-IETD-FMK mw STE3 S: ACAATCGGTATATAACCAATACACAGTAG AS: GTTGTCCAGCACCGTCGATA BEM1 S: TGGAAGAAGATGACGGCGGAAT AS: TGTGGCTTTGTTGTAGGTGAGGG HMK1 S: CGTGGCAGCACAGACAATGC AS: GGCGGATTTGCAAGGACGT PKC1 S: CCGAAAGTCGTCACCAAGTG AS: CATGTAAGACTGCATTCTGAGC Western Blot An amount of organism equivalent to 10

μL was taken from an HMM plate kept at 37°C. 30 μL of Laemelli sample buffer was added and samples were boiled for 15 min. Samples were electrophoresed by SDS-PAGE using a precast 8-16% tris-glycine gel (Invitrogen) and transferred to a nitrocellulose membrane. Membranes were either incubated at room temperature for 2 hours with a 1:1000 dilution of anti-Myc alkaline phosphatase tagged antibody (Invitrogen), or with a 1:5000 dilution of rabbit anti-HSP60 antibody (a kind gift from Francisco Gomez, University of Cincinnati, Cincinnati, OH) as a loading control. Anti-HSP60 antibodies were secondarily tagged with a 1:1000 dilution of peroxidase labelled goat-anti-rabbit antibody (Kirkegaard and Perry Laboratories).

Phosphatase labelled antibodies CDK inhibitor were developed using BCIP/NBT phosphatase substrate (Kirkegaard and Perry Laboratories), and peroxidase labelled antibodies were developed using TMB One Component, HRP membrane substrate (BioFx Laboratories). Developed membranes were imaged using a FOTO/Analyst® FX system from Fotodyne®, Inc. Microarray Microarray analysis was performed in conjunction with the University of Cincinnati Genomics and Microarray oxyclozanide laboratory. Three samples of G217B and UC26 were grown at

25°C on nylon membranes placed on HMM plates as described above. RNA was extracted using TRIzol® reagent (Invitrogen) according to manufacturer’s instructions. Cy-3 and Cy-5 labelled cDNA from UC26 and G217B was hybridized to a slide containing 70-mer oligonucleotides representing each putative open reading frame in the H. capsulatum genome (Washington University Genome Sequencing Center, Washington University, St. Louis, MO). Dye swaps were also performed. Slides were imaged using a GenePixPro 4000 scanner (Axon Instruments), using Axon GenePix® Pro version 5.0 software. Cy3 and Cy5 intensities were normalized by subtracting local background intensities from the median intensity of each channel. Statistical analysis was performed by the University of Cincinnati Bioinformatics F&S Core of the Center for Environmental Genetics, as previously described [41]. Functional analysis was performed using BLAST2GO http://​www.​blast2go.

The age-adjusted incidence and death rates for ovarian cancer are 13.3 and 8.8 per 100,000, respectively. The average five-year survival rate for ovarian cancer patients

is ~46%. This high overall mortality is a consequence of a failure to detect this disease at an early stage. As there are no clinically overt early symptoms, most women (~75%) are first diagnosed with disseminated disease (Stage III/IV) when prognosis is poor. Despite recent progress in chemotherapeutic treatments, the diagnosis of late stage disease is associated with a five-year survival rate of ~30%. In contrast, when ovarian cancer is identified at an early stage, five year survival increases to ~90%. Thus, the development of more accurate Erlotinib and earlier detection tests for this disease are undoubtedly the number one priority for achieving long-term reduction of mortality from ovarian cancer

[1]. Currently, plasma or serum CA125 concentration is the best characterised and most widely used ovarian cancer biomarker and is elevated in more than 80% of patients with epithelial ovarian cancer [2]. CA125 concentrations, however, are increased in only ~ 50% of patients with Stage I disease [3]. Thus, more accurate and earlier detection tests are requisite to reducing the mortality associated with this disease. Previously, we and others have reported the utility of combining biomarkers Selleck PS341 to develop classification algorithms for identifying of women with ovarian cancer [4–10]. Such studies establish proof-of-concept and the potential to improve diagnostic efficiency by combining multiple ovarian cancer biomarkers. The sensitivity and specificity of such panels, however, must be further improved and additional informative biomarkers that contribute to multivariate modelling need to be identified. The purpose of this study was to characterise changes in the plasma concentrations of MDK in association

with ovarian cancer and compare its diagnostic performance (as assessed by the AUC) with that of AGR2 (a recently reported circulating biomarker of ovarian cancer [11]) and CA125 in symptomatic women. Available data are consistent with a putative role for both AGR2 and MDK in oncogenesis and tumor progression, including ovarian cancer. Materials and methods Control and ovarian cancer plasma samples Plasma samples were collected from healthy women (median age 52, range 32-69 years, n = 61) and women at the time of diagnosis of ovarian cancer and before treatment (median age 61, range 24-69 years, n = 46). The project was approved by the Mercy Hospital for Women Human Research and Ethics Committee (R09/06). All case samples and part of the control sample set used in this study were provided by the Biobank at Peter MacCallum Cancer Research Institute (Melbourne, Australia) and all subjects participated in the study after signing an informed written consent.

The sample was infused with a flow rate of 10 μl/min. MAS NMR sample preparation Selectively isotope-enriched Synechocystis cells were harvested by centrifugation and washed once with buy Palbociclib standard BG-11 medium. The pellet was resuspended in a 100 μl of standard BG-11 under low light conditions. The sample was bubbled shortly with nitrogen to remove oxygen and quinone reduced by adding sodium dithionite to a final concentration of 100 mM under oxygen free and near dark conditions. After 30 min of incubation in the dark at room temperature, the sample was loaded into an optical transparent 4-mm sapphire MAS rotor under oxygen free conditions.

The sample was inserted into the NMR spectrometer right away. The isolated samples of PS1 and PS2 from spinach (Spinacia oleracea) at natural abundance have been prepared following the procedures described in Matysik et al. (2000) and Alia et al. (2004). Photo-CIDNP MAS NMR experiments

13C-MAS NMR experiments were performed on a DMX-200 NMR spectrometer (Bruker Biospin GmbH, Karlsruhe, Germany). All spectra have been obtained at a sample temperature of 235 K and a spinning speed of 8 kHz. The spectra were collected with a spin echo pulse sequence with the CYCLOPS phase cycle of (π/2) pulse under TPPM carbon-proton decoupling. Photo-CIDNP MAS NMR spectra have been obtained under continuous illumination with a 1,000-W xenon arc lamp. Results and discussion Determination of the 13C label incorporation The biosynthetic route from [4-13C]-ALA to Chl a is depicted in Fig. 2. Two molecules of [4-13C]-ALA are asymmetrically condensed to form the pyrrole porphobilinogen (PBG). Kinase Inhibitor Library Four molecules of PBG tetramerize,

and prior to macrocycle ring closure, the last pyrrole ring is inverted via a spiro-intermediate (Schulten et al. 2002). Upon incorporation of [4-13C]-ALA, a maximum of 8 13C can be pair wise incorporated into each Chl a molecule, resulting into the specific labeling pattern shown in Fig. 2 with 13C isotopes incorporated on position C-1/C-3, C-6/C-8, C-11/C-13, and C-17/C-19. The level of [4-13C]-ALA incorporation was determined quantitatively by LC-MS Sodium butyrate analysis. Chl a pigments were extracted from Synechocystis cells grown in [4-13C]-ALA supplemented BG-11 (labelled sample), and normal BG-11 medium (reference sample). Figure 3 shows the LC-MS spectra observed in the region of m/z = 893.5 ([M]+; C55H72O5N4Mg) from the reference (A) and the labelled sample (B). The total level of incorporation (P tot) was determined through an iterative procedure as described earlier in (Schulten et al. 2002) making use of a weighted sum according to the formula: $$ P_\texttot = \sum\limits_n\; = \;0^8 \fracn8 \times P_n $$ (1)where n stands for the number of labels present in an isotopomer and P 0 is the corresponding fraction of unlabelled Chl a estimated from the isotopic labeling pattern detected from the reference sample (Fig. 3a).

3′hrcR indicates hrcR gene deleted in 5′-end and 5′hrcT indicates hrcT gene deleted in 3′-end. The arrow above the genes represents the operon transcription. A bold line represents DNA from pME3087. HindIII and EcoRI are enzymes used to clone hrcRST in pME3087. Unknown indicates putatives hrc genes located upstream or downstream hrcRST genes. Figure

7 Cell-associated hemolytic activity and swimming motility of MFN1032, MFN1030 (MFN1032 hrc RST-disrupted mutant) and MFN1031 (revertant). A: Hemolysis of RBCs incubated with MFN1032, MFN1030 and MFN1031 at 28°C and a MOI of 1. Results are means of at least three independent experiments. Standard deviation is shown. Contact was enhanced by centrifugation at 400 g for 10 min. B: Swimming motility of MFN1032, MFN1030 and MFN1031. Swimming motility was determined, as described in the methods, on 0.3% LB agar after 16 h of incubation at 28°C. MFN1032, MFN1031 and MFN1030 formed concentric halos corresponding to find more swimming motility. Given the homology between hrcS and fliP, we investigated the

potential role of hrcRST genes in flagellar synthesis. The effect of disrupting the hrpU operon in MFN1030 was measured in swimming mobility assays, as described in the methods. At 28°C, we observed no differences in swimming ability between GS-1101 manufacturer MFN1032, MFN1030 and MFN1031 (Figure 7B), suggesting that disruption of this operon has no effect on flagella motility. Discussion To our knowledge this is the first study to demonstrate cell-associated hemolytic activity in clinical isolates of a Pseudomonas fluorescens. P.fluorescens MFN1032 cell in exponential growth phase displayed hemolytic activity at 37°C, whereas no hemolytic activity was detected using MFN1032 supernatant. This hemolytic activity was thus dependent on the presence of MFN1032 cells. MFN1032 cells caused hemolysis of RBCs without requiring prior centrifugation to reduce the distance between bacterial and red cell membrane below a critical threshold. Such a centrifugation step has previously been shown to be necessary to induce

the “”contact-dependent”" Arachidonate 15-lipoxygenase hemolytic activity displayed by several other bacteria, for example Yersinia [27], Shigella [28] and Pseudomonas aeruginosa [25]. In contrast, “”induced”" hemolysis does not require close RBC-bacterial contact for enteropathogenic Escherichia coli EPEC, due to the long EspA (TTSS secreted protein) filaments that form a connection between bacteria and host cells for protein translocation [29, 30]. MFN1032 hemolytic activity was not strictly contact-dependent but depended on the presence of MFN1032 cells. We therefore propose the term “”cell-associated”" hemolytic activity. This activity is independent of the secreted hemolytic activity previously described for this strain. For all tested conditions, we have previously demonstrated that secreted hemolytic activity only occurs at the end of the exponential growth phase [11].

with Helminthosphaeria

cf. odontiae, Quaternaria quaternata, holomorph, 24 Sep. 2003, W. Jaklitsch, W.J. 2414–2420 (combined as WU 29243, cultures C.P.K. 969–973). Záton, Boubínský prales (NSG), MTB 7048/2, 48°58′03″ N, 13°49′24″ E and 48°58′30″ N, 13°49′15″ buy BTK inhibitor E, elev. 900–1000 m, on mostly decorticated branches of Fagus sylvatica 2–11 cm thick, on wood and bark, soc. pyrenomycetes, Corticiaceae, Bisporella citrina, Oligoporus subcaesius, holomorph, 4 Oct. 2004, W. Jaklitsch, W.J. 2759 + 2760 (WU 29270, culture C.P.K. 1965, 1966). Žofín, Žofínský prales (NSG), MTB 7354/1, 48°40′13″ N, 14°42′28″ E to 48°40′07″ N, 14°42′22″ E, elev. 820 m, on branches of Fagus sylvatica 2–7 cm thick, on wood, in bark fissures, soc. white mould, holomorph, 26 Sep. 2003, W. Jaklitsch, W.J.

2429–2431 (WU 29244, cultures C.P.K. 978, 2392, 2393). Denmark, Soenderjylland, Roedekro, Rise Skov, between Roedekro and Aabenraa, 55°03′34″ N, 09°22′01″ E, elev. 70 m, on partly decorticated branch of Fagus sylvatica 15–20 cm thick, on wood and bark and stromata of Hypoxylon fragiforme, soc. Calocera cornea, 23 Aug. 2006, H. Voglmayr & W. Jaklitsch, W.J. 2937 (WU 29274, culture C.P.K. 2443). Estonia, Harjumaa Co., Põhja-Kõrvemaa Temsirolimus molecular weight landscape reserve, on wood, 28 Oct. 2007, K. Põldmaa K.P. 375. France, Lorraine, Vosges, Col de la Schlucht, Route des Crêtes, Gazon du Faing, Forêt des Hospices de Nancy, 48°07′24″ N, 07°04′11″ E, elev. 1000 m, on decorticated branch of Fagus sylvatica 8 cm thick, on black wood, soc. Phlebia sp., effete pyrenomycetes, 4 Sep. 2004, W. Jaklitsch & H. Voglmayr, W.J. 2675 (WU 29263, culture C.P.K. 1956). Moselle, Lorraine, Pont a Mousson, close to the motorway Nancy/Metz, 48°55′26″ N, 06°05′55″ E, elev. 200 m, on decorticated

branch Erastin of Fagus sylvatica 5–7 cm thick, along the whole branch, soc. Hypocrea lixii, holomorph, 5 Sep. 2004, W. Jaklitsch & H. Voglmayr, W.J. 2682 (WU 29264, culture C.P.K. 1957). Germany, Baden Württemberg, Freiburg, Landkreis Breisgau-Hochschwarzwald, St. Märgen, parking area Holzschlag, MTB 8014/2, 47°59′53″ N, 08°05′03″ E, elev. 620 m, on partly decorticated cut log of Abies alba 18–22 cm thick, on wood and bark, soc. Armillaria rhizomorphs, Trichaptum abietinum, Exidiopsis sp., 2 Sep. 2004, H. Voglmayr & W. Jaklitsch, W.J. 2667 (WU 29262, culture C.P.K. 1955). Tübingen-Pfrondorf, Tiefenbach, Einsiedlerweg, on branch of Fagus sylvatica, on wood, 20 Oct. 2002, W. Jaklitsch & H.O. Baral, W.J. 2006. Bavaria, Oberbayern, Altmühltal, Eichstätt, 2–3 km after Pfahldorf heading to Eichstätt, MTB 7033/4, 48°57′00″ N, 11°18′20″ E, elev. 540 m, on decorticated branch of Fagus sylvatica 4 cm thick, on wood, soc. Corticiaceae, holomorph, 5 Aug. 2004, W. Jaklitsch & H. Voglmayr, W.J. 2574 (WU 29255, culture C.P.K. 1947). Habach, Thomamühle, south of the road B472, elev. 640 m, MTB 8233/4/23, on branch of Picea abies, on bark, 23 Dec. 2008, P. Karasch, WU 29528.

But on the final day of performance, Govindjee failed to deliver the dialogues of my inner voice from off-stage. He had dropped the unnumbered pages of the script on the floor, and, thus, the text was messed up. I was nervous. I kept on repeating my dialogue in the hope that the next dialogue would be heard from the off-stage. But there was no response. The play

suddenly came to a grinding halt. The audience came to know that the play had come apart. They started hooting, booing and whistling. I shouted—‘Drop the Curtain’. The play was over. I rushed into the wings, seething with anger. But Govindjee was not there. He had vanished for fear of being scolded by me. However, after a few days, he came to see me and explained what had happened. I, selleck kinase inhibitor of course, forgave him for this. Govindjee, sometimes, tells this story with relish. We had founded a literary club named “Aaok”, which met every Friday in a restaurant, or in the home of a friend (Amarnath Bhargava). We read papers on different subjects,

held discussions on contemporary issues, and sometimes invited distinguished persons to speak to us. Govindjee’s participation in “Aalok” was regular and enthusiastic. click here Most of us read papers or talked on subjects, not necessarily limited to the subjects we were pursuing in the University. But Govindjee invariably confined himself to subjects of study for his university degree. He was furiously focused on his academic studies. With his diverse activities, he would not allow his studies to be ignored. One of our mutual friends Mahesh Bharti who had lived at Govindjee’s house for sometime told me that even on the days Govindjee would say that he was feeling unwell, he would sit on his study table for 4–5 h at a stretch. Not surprising, he topped in his BSc and MSc classes. Today, almost while writing this, I look back at the life of Govindjee, and I am reminded of ‘Arjun’, a well-known character in the great Indian epic Mahabharat. Arjun and his brothers were learning archery

from their Guru (the teacher) Drona. One day the Guru decided to test the skills of his disciples. He declared that one who would pierce the eye of the bird sitting on the tree would be declared winner. Accordingly, one of the disciples aimed his arrow at the eye of the bird. The Guru asked him does he see the bird? Does he see the feathers of the bird? Does he see the beak of the bird? The disciple replied in affirmative. Then he shot the arrow but missed the bird’s eye. Similarly, all other disciples of the Guru, except Arjun, admitted seeing the bird, its feathers and its beak while aiming at its eye. They failed to hit the eye. At last, Arjun was summoned. When he aimed his arrow at the eye of the bird, the Guru asked him if he was seeing the bird. Arjun replied—‘No’. Guru again asked him if he was seeing bird’s feather or beak. Arjun replied—‘No’. Guru asked him—‘What do you see?’ Arjun replied—‘I see the bird’s eye. Only the eye, and nothing else.

Journal of Clinical Microbiology 2006,44(5):1859–1862.PubMedCrossRef Authors’ contributions RCLM: Study design, primers design, fieldwork and data collection, laboratory tests, data analysis, manuscript writing; ASR: Study design, primers design, laboratory tests, data analysis, manuscript writing; FFM: Primers

design, laboratory test, data analysis, manuscript writing; MASC: Fieldwork, data collection and analysis, manuscript writing; KDE: Fieldwork and data collection; ADF: Fieldwork and data collection; LMSM: Diagnostic laboratorial tests; MSL: Data interpretation and analysis, manuscript writing; BW: Coordination, study design, fieldwork and data collection, data analysis, manuscript writing. All authors read an approved the final draft.”
“Background The animal gastrointestinal NVP-AUY922 mw tract harbors a complex microbial network and its composition reflects the constant co-evolution of these microorganisms with their host environment [1]. Uncovering the taxonomic composition and functional capacity within the animal

gut microbial consortia is of great importance to understanding the roles they play in the host physiology and health. Since animal feces can harbor human pathogens, understanding the genetic composition check details of fecal microbial communities also has important implications for food and water safety. The structure and function of the gut microbial community has received significant attention for decades, although most of the work was restricted by the use of culture-based techniques. Recently, sequence Oxymatrine analysis of the 16S rRNA gene has shed new light on the diversity and composition of microbial communities within several animal gut systems [2]. While 16S rRNA gene-based techniques have revealed impressive microbial diversity within gut environments, this approach offers only limited information on the physiological role of microbial consortia within a given gut environment. Random sequencing of metagenomes has allowed scientists to reveal significant differences in metabolic potential within different environments [3], including microbial populations associated with host-microbial partnerships. Specifically,

the publicly available database IMG/M [4] contains 596 Mb of sequencing data, representing 1,424, 000 genes from 17 different gut microbiomes. Studying gut metagenomes has particularly helped in uncovering several important biological characteristics of these microbiomes. For example, when 13 human gut metagenomes were compared, Kurokawa et al [5] found that adult and infant type gut microbiomes have enriched gene families sharing little overlap, suggesting different core functions within the adult and infantile gut microbiota. This study also demonstrated the presence of hundreds of gene families exclusively found in the adult human gut, suggesting various strategies are employed by each type of microbiota to adapt to its intestinal environment [5].

Results obtained could help to better

define strategies for pathogenicity studies and control strategies in C. perfringens and can moreover be used to design focused wet-lab experiments. Table 1 Genomes and plasmids analyzed C.p. Strain Type (name) Sequencing Status N Genes Length (nt) Str. 13 G Finished 2905 3085740 ATCC 13124 G Finished 3066 3256683 ATCC 3626 G Draft 3427 3896305 C JGS1495 G Draft 3254 3661329 CPE F4969 G Draft 3118 3510272 D JGS1721 G Draft 3485 4045016 E JGS1987 G Draft 3729 4127102 SM101 G Finished 2748 2921996 C. perfringens P (pBCNF5603) Finished 36 36695 C. perfringens P (pCP8533etx) Finished 63 64753 F4969 P (pCPF5603) Finished 73 75268 F5603 P (pCW3) Finished 51 47263 F5603 P (pCPF4969) Finished 62 70480 SM101 P (1) Finished Belinostat 10 12397 SM101 P (2) Finished 11 12206 Str. 13 P (pCP13) Finished 63 54310 List of genomes and plasmids used in

this study. The Type column indicates if a sequence is a genome (G) or a plasmid (P) in that case we also indicate the name of the plasmid within round parentheses. C.p. stands for Clostridium perfringens. Results and Discussion Comparisons of C. perfringens strains As a preliminary analysis we studied the variability of the selected genomes using both standard check details phylogenetic techniques and a comparison of all intergenic sequences. The alignment of rrnA operons for a total of 4719 nt was used to build a Neighbor-Joining tree revealing that these strains are closely related [Additional file 1: panel a]. In agreement with a low differentiation on ribosomal operon sequences, bootstrap support for the branching pattern was quite low; in fact, 32 variable sites only were found in the alignment,

which were evenly distributed between strains [Additional file 1: panel b]. However, the comparison of a large number of intergenic sequences extracted from the genomes revealed that some of them are quite variable between the different strains with respect to the very conserved rrnA operon (down to 82% with respect to C. perfringens Str. 13, [Additional file 1: panel Phosphoribosylglycinamide formyltransferase c]). Regulon prediction in sequenced C. perfringens strains The presence of VirR and VirS sequences was checked in all strains using blast and the functionally characterized sequences of Str. 13 as queries. We found that they are indeed both present in all strains and that they are moreover always organized in what resembles a bi-cistronic operon with the two genes often overlapped (data not shown). We scanned available C. perfringens genomes using the VirR position weight matrix (PWM) derived from experimental observations, following the procedure reported in figure 1 (see Methods for details). At the time we performed this analysis (April, 2009), the NCBI microbial genome database stored three different complete genomes for C.