) D ccg ctcgag caattcaacattgcaaagac Reverse, XhoI site (underline

) D ccg ctcgag caattcaacattgcaaagac selleck chemicals Reverse, XhoI site (underlined), located 294 nucleotides upstream

of the start codon of the gene encoding a putative glycosyl hydrolase family 20 (Figure 1.) E cga gggccc gtgaagtattgccagatgt Forward, ApaI site (underlined); located 592 nucleotides downstream of the down gene (hypothetical, Figure 1.) F ccg Emricasan clinical trial gaattc aaaagcagaattggaaatca Reverse, EcoRI site, 1,571 nucleotides downstream of the down gene (hypothetical, Figure 1.) G gc gagctc gattactttcaa aggaga Forward, SacI site (underlined), ribosomal binding site of hyl Efm (italics) (Figure 1.) H tcc cccggg cta acttttgataatttgctc Reverse, SmaI site, (underlined) and stop codon of hyl Efm (Figure 1.) I tcc cccggg tta gcgattgatcgagc Reverse, SmaI site (underlined), stop codon of down (Figure 1.) J cg ggatcc caatcaagaagtagcggatt Forward, BamH site (underlined) 438 nucleotides upstream of the stop codon

of carbohydrate ABC transporter gene (Figure 1.) K gcggccgctcgagggcccttagtgcgattgtatctgac Reverse, stop codon of the gene that encodes to transmembrane protein (Figure 1.) L gggcccctcgaggcggccgc aaaattaaataaaaaatgg Forward, ApaI, XhoI, NotI site, stop codon down (Figure 1.) M c atgcat gaatcaggaactgaaactgc Reverse, NsiI site, 1,091 nucleotides upstream of stop codon of GMP synthase (opposite orientation) (Figure 1.) N ccg gaattc heptaminol cagtaaaaggcacagagc Forward, EcoRI site (underlined), located 2,138 nucleotides down-stream of Doramapimod price glycosyl hidrolase

family 45-2 start codon (Figure 1.) O tcatctattttctcctttgaaagtaatcactatattcc Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.) P tcaaaggagaaaatagatgaatatcttaaaaaataaaaagc Forward, located 40 nucleotides upstream of down gene start codon (Figure 1.) Q ataagaat gcggccgc ttagcgattgatcgagcg Reverse, NotI site (underlined), stop codon of down (Figure 1.) R ataagaat gcggccgc cagtaaaaggcacagagc Forward, NotI site (underlined), located 2,138 nucleotides down-stream of glycosyl hydrolase family 45-2 start codon (Figure 1.) S tcatctattttctcctttgaaagtaatcactatattcc Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.) T tcaaaggagaaaatagatgacaaaattaaataaaaaatgg Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (Figure 1.) U cg gaattc gaatttgtatatgtcttcg Reverse, EcoRI site (underlined), 994 nucleotides upstream of start codon of GMP synthase (opposite direction) (Figure 1.) V aaggaaaaaa gcggccgc cagaatatgataatcgtcatgg Forward, NotI site (underlined), 902 nucleotides downstream of hyl Efm start codon (Figure 1.) W tttgttctcctttttcttgctttttattttttaag Reverse, stop codon of of hyl Efm (Figure 1.) X gcaagaaaaaggagaacaaacaaaattaaataaaaaatgg Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (opposite direction) (Figure 1.

Comments are closed.