After shaking, this siRNA-Lipofectin2000 mixture was then added to a 6-well plate (1.5 ml of Opti-MEM in each well). Six hours later, the medium was replaced with complete medium. Our previous study confirmed that we obtained the maximal transfection efficacy when the ratio of Lipofectin2000 to siRNA was 4 μl:4 μl. MTT assay Six hours after transfection, HCT116 cells were digested, re-suspended and seeded in a 96-well culture plate. After 24, 48 and 72 h of

incubation, cells were stained with 20 μl 3-(4, 5-Dimethylthiazol-2-yl)-2, www.selleckchem.com/products/ABT-263.html 5-diphenyltetrazolium bromide Methylthiazolyl tetrazolium (MTT) solution (5 mg/ml) at 37°C for 4 h and subsequently made soluble in 150 μl of DMSO. Absorbance (A) was measured at 490 nm with an automated plate reader. Each sample was triplicated and the experiment was repeated three times. Cell growth curves were

calculated as mean values of each group. Flow cytometric analysis Cells were trypsinized and centrifuged at 1500 rpm/min for 5 min at 48 h after transfection. Cells were harvested and washed with Phosphate Buffered Saline (PBS) twice. Reagents for apoptosis detection were added, and then cells were incubated in dark for 30 min and subjected AZD2014 ic50 to flow cytometry analysis (FACS). Additionally, cells were Foretinib clinical trial collected, washed with PBS, fixed with 75% ethanol at-20°C overnight, and centrifuged at 1500 rpm/min for 5 min. Then, ethanol was removed and cells were washed with PBS twice. Propidium iodide (PI) and 500 μl of RNAse were added, and then cells were incubated in dark at 4°C for 60 min. Lastly, cells were subjected to cell cycle analysis by FACS. Gene expression analysis (RT-PCR and real-time PCR) The mRNA expression of CDK8 and β-catenin in HCT116 cells after CDK8-siRNA transfection were quantified by RT-PCR. Total RNA was extracted from Fludarabine cells with Trizol and subjected to reverse transcription into cDNA. CDK8 and β-catenin were amplified

from the cDNA by RT-PCR. The PCR conditions consisted of 5 min at 94°C one cycle, 30 s at 94°C, 40 s at 55°C, 45 s at 72°C, and 7 min at 72°C 40 cycles. The primer sequences were as follows: 5′-TCACCTTTGAAGCCTTTAGC-3′ (forward) and 5′-CTGATGTAGGAAGTGGGTCT-3′ (reverse) for CDK8; 5′-TGCCAAGTGGGTGGTATAGAG-3′ (forward) and 5′-TGGGATGGTGGGTGTAAGAG-3′ (reverse) for β-catenin; 5′CTGGGACGACATGGAGAAAA3′ (forward) and 5′AAGGAAGGCTGGAAGAGTGC3′ (reverse) for β-actin. The mRNA expression of CDK8 and β-catenin in colon cancer samples (n = 12) were quantified by real-time PCR. Informed consent was obtained from all the patients, and research protocols were approved by Independent Ethics Committee (IEC) of our hospital.